Preimplantation and prenatal genetic diagnosis for androgen insensitivity syndrome resulting from a novel deletion/insertion mutation.

To the Editor : Androgen insensitivity syndrome (AIS, testicular feminization; OMIM #300068) is an X-linked recessive genetic disorder caused by mutations in the androgen receptor gene (AR; OMIM# 313700) (1). The AR gene is a single-copy gene that is located on Xq11–12 and consists of eight exons. To date, more than 800 mutations in the AR gene have been found to cause AIS (http://androgendb.mcgill.ca/AR23C.pdf). Here, we report a case of AIS with a novel AR mutation and preimplantation and prenatal genetic diagnosis using AR mutational analysis. A 39-year-old woman who was suspected to be a carrier of an AR gene mutation was referred to our hospital. The proband is her 11-year-old child who is phenotypically female with female external genitalia and presented to the local hospital with bilateral inguinal hernia. Chromosome analysis revealed a karyotype of 46, XY. Plasma testosterone and E2 were 203.0 ng/dl and 24.1 pg/ml, respectively. A sonographic examination reported absence of uterus and presence of testes in the inguinal canals. On the basis of those findings, the child was diagnosed of AIS. By analyzing all the eight exons and flanking intron regions of the AR gene using the primers listed in Table 1 (primer set 1–12), a novel deletion/insertion mutation c.933_1219del287ins77 (AGATTTATTTCT ATATCTATAAAATTAGAATACATATCTGGTTGTGA TAAGTATTTTAAAAGAGATAGAAATAAAGG) was identified in exon 1 of the proband’s AR gene, which is a frameshift mutation resulting in an early stop codon (p.Phe312Aspfs*7). The primer set 13–14 was used to amplify the deletion/insertion sequence of exon 1. The product was 349 bp for the normal allele and the mutant polymerase chain reaction (PCR) product was a shorter band of 139 bp. The proband’s mother and maternal grandmother were heterozygous for the mutant allele, and his father, maternal grandfather and maternal uncle had the normal allele (Fig. 1a). The couple decided to undergo preimplantation genetic diagnosis (PGD). In vitro fertilization (IVF) PGD cycle was initiated after the couples signed written informed consent. However, only four mature size follicles had developed after controlled ovarian stimulation due to advanced maternal age. The peak serum E2 level was 3983 pmol/l (basal Follicle-stimulating Table 1. Primers used in AR gene mutation screening, amplification of deletion/insertion sequence of exon 1 and SRY gender marker