Preimplantation and prenatal genetic diagnosis for androgen insensitivity syndrome resulting from a novel deletion/insertion mutation.
نویسندگان
چکیده
To the Editor : Androgen insensitivity syndrome (AIS, testicular feminization; OMIM #300068) is an X-linked recessive genetic disorder caused by mutations in the androgen receptor gene (AR; OMIM# 313700) (1). The AR gene is a single-copy gene that is located on Xq11–12 and consists of eight exons. To date, more than 800 mutations in the AR gene have been found to cause AIS (http://androgendb.mcgill.ca/AR23C.pdf). Here, we report a case of AIS with a novel AR mutation and preimplantation and prenatal genetic diagnosis using AR mutational analysis. A 39-year-old woman who was suspected to be a carrier of an AR gene mutation was referred to our hospital. The proband is her 11-year-old child who is phenotypically female with female external genitalia and presented to the local hospital with bilateral inguinal hernia. Chromosome analysis revealed a karyotype of 46, XY. Plasma testosterone and E2 were 203.0 ng/dl and 24.1 pg/ml, respectively. A sonographic examination reported absence of uterus and presence of testes in the inguinal canals. On the basis of those findings, the child was diagnosed of AIS. By analyzing all the eight exons and flanking intron regions of the AR gene using the primers listed in Table 1 (primer set 1–12), a novel deletion/insertion mutation c.933_1219del287ins77 (AGATTTATTTCT ATATCTATAAAATTAGAATACATATCTGGTTGTGA TAAGTATTTTAAAAGAGATAGAAATAAAGG) was identified in exon 1 of the proband’s AR gene, which is a frameshift mutation resulting in an early stop codon (p.Phe312Aspfs*7). The primer set 13–14 was used to amplify the deletion/insertion sequence of exon 1. The product was 349 bp for the normal allele and the mutant polymerase chain reaction (PCR) product was a shorter band of 139 bp. The proband’s mother and maternal grandmother were heterozygous for the mutant allele, and his father, maternal grandfather and maternal uncle had the normal allele (Fig. 1a). The couple decided to undergo preimplantation genetic diagnosis (PGD). In vitro fertilization (IVF) PGD cycle was initiated after the couples signed written informed consent. However, only four mature size follicles had developed after controlled ovarian stimulation due to advanced maternal age. The peak serum E2 level was 3983 pmol/l (basal Follicle-stimulating Table 1. Primers used in AR gene mutation screening, amplification of deletion/insertion sequence of exon 1 and SRY gender marker
منابع مشابه
Genotype versus phenotype in families with androgen insensitivity syndrome.
Androgen insensitivity syndrome encompasses a wide range of phenotypes, which are caused by numerous different mutations in the AR gene. Detailed information on the genotype/phenotype relationship in androgen insensitivity syndrome is important for sex assignment, treatment of androgen insensitivity syndrome patients, genetic counseling of their families, and insight into the functional domains...
متن کاملIdentification of the rs797045105 in the SERAC1 gene by Whole-Exome Sequencing in a Patient Suspicious of MEGDEL Syndrome
Whole Exome Sequencing (WES) has been increasingly utilized in genetic determinants of various inherited diseases. We identified a new variation in SERAC1 as the cause of 3-Methylglutaconic Aciduria (MEG), Deafness (D), Encephalopathy (E), and Leigh-like (L), MEGDEL syndrome using WES. We found an insertion, rs797045105 (chr6, 158571484, C>CCATG), in the SERAC1 gene with homozygous genotype in ...
متن کاملAndrogen receptor genotyping in a large Australasian cohort with androgen insensitivity syndrome; identification of four novel mutations.
We genotyped the androgen receptor (AR) gene in 31 Australasian patients with androgen insensitivity syndrome (AIS). The entire coding region of AR was examined including analysis of polymorphic CAG and GGN repeats in all patients. AR defects were found in 66.7% (6/9) of patients with complete AIS (CAIS) and 13.6% (3/22) of patients with partial AIS (PAIS). A novel deletion (N858delG) leading t...
متن کاملIdentification of a Novel Intragenic Deletion of the PHKD1 Gene in a Patient with Autosomal Recessive Polycystic Kidney Disease
Background Autosomal recessive polycystic kidney disease (ARPKD) is caused by mutations in the PKHD1gene. In the present study, we describe a severe case of ARPKD carrying a point mutation and a novel four-exon deletion of PKHD1 gene. Materials and Methods The PKHD1, PKD1 and PKD2 ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Clinical genetics
دوره 82 3 شماره
صفحات -
تاریخ انتشار 2012